Review



genomic dna - human adult normal tissue: peripheral blood leukocyte #cp-d300d1234148  (BioChain Institute)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    BioChain Institute genomic dna - human adult normal tissue: peripheral blood leukocyte #cp-d300d1234148
    Genomic Dna Human Adult Normal Tissue: Peripheral Blood Leukocyte #Cp D300d1234148, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/genomic+dna+++human+adult+normal+tissue++peripheral+blood+leukocyte++cp+d300d1234148/pm35914404-50-14-27
    Average 90 stars, based on 1 article reviews
    genomic dna - human adult normal tissue: peripheral blood leukocyte #cp-d300d1234148 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Retrovirus insertion site analysis of LGL leukemia patient genomes
    Article Snippet: .. A 25 μl PCR reaction was performed using human adult normal peripheral blood leukocyte genomic DNA purchased from Biochain (Cat. #D8234148–1, Lot #B511221) and the following primer pairs: Chr1_5HK For (5’CATAGCAAATCCCAGTGTAGACATC3’) and Chr1_5HK Rev. (5’CTGGGAGCATTTCTGGACATC3’); Chr1_PREINT For (5’CACCGCACCTGGCAAGTTTACA3’) and Chr1_PREINT Rev. (5’ATTTGGGGTCCTCATGAAGCAGAA3’); Chr19_3HK5 For (5’TACCCCAAGACCAAAAATAATAAG3’) and Chr19_3HK6 Rev. (5’CTGATAGTGGCAAGATGGATGTA3’); C19PRE3 For (5’GAACAGGAGCATGCTCATAGTGTGT3’) and C19PRE4 Rev. (5’GGTCTCGAACTCCTAACCTCCTG3’); Chr12PREINT For (5’TACTGGGAATAAGATGATGATGGT3’) and Chr12PREINT Rev. (5’TTTGTTAAGTGCTCGGAAGGT3’); Chr10HK1 For (5’ACGCGTGGGTATATCGGTTTATTTCT3’) and Chr10HK2 Rev. (5’GGCTGGTTCTTTATTATTTATGGCTGGT3’); Chr12HK5_1 For (5’GCAGTTCCACCTTCCCGACAGC3’) and Chr12HK5_2 Rev. (5’ACACAGGACCAAAAGAACGAGTAATC3’). ..

    Article Title: Retrovirus insertion site analysis of LGL leukemia patient genomes
    Article Snippet: .. A 25 μl PCR reaction was performed using human adult normal peripheral blood leukocyte genomic DNA purchased from Biochain (Cat. #D8234148-1, Lot #B511221) and the following primer pairs: Chr1_5HK For (5′CATAGCAAATCCCAGTGTAGACATC3′) and Chr1_5HK Rev (5′CTGGGAGCATTTCTGGACATC3′); Chr1_PREINT For (5′CACCGCACCTGGCAAGTTTACA3′) and Chr1_PREINT Rev (5′ATTTGGGGTCCTCATGAAGCAGAA3′); Chr19_3HK5 For (5′TACCCCAAGACCAAAAATAATAAG3′) and Chr19_3HK6 Rev (5′CTGATAGTGGCAAGATGGATGTA3′); C19PRE3 For (5′GAACAGGAGCATGCTCATAGTGTGT3′) and C19PRE4 Rev (5′GGTCTCGAACTCCTAACCTCCTG3′); Chr12PREINT For (5 ′TAC T GGGAAT AAGAT GAT GAT GGT3′) and Chr12PREINT Rev (5′TTTGTTAAGTGCTCGGAAGGT3′); Chr10HK1 For (5′ACGCGTGGGTATATCGGTTTATTTCT3′) and Chr10HK2 Rev (5′GGCTGGTTCTTTATTATTTATGGCTGGT3′); Chr12HK5_1 For (5′GCAGTTCCACCTTCCCGACAGC3′) and Chr12HK5_2 Rev (5′ACACAGGACCAAAAGAACGAGT AATC3′). ..



    Similar Products

    97
    AMS Biotechnology leukocyte
    Leukocyte, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/Genomic+DNA+-+Human+Adult+Normal+Tissue%3A+Peripheral+Blood+Leukocyte%2C+from+a+single+donor/bio_rxiv__2022__02__11__480085-64-13-14
    Average 97 stars, based on 1 article reviews
    leukocyte - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    90
    BioChain Institute genomic dna - human adult normal tissue: peripheral blood leukocyte #cp-d300d1234148
    Genomic Dna Human Adult Normal Tissue: Peripheral Blood Leukocyte #Cp D300d1234148, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/genomic+dna+++human+adult+normal+tissue++peripheral+blood+leukocyte++cp+d300d1234148/pm35914404-50-14-27
    Average 90 stars, based on 1 article reviews
    genomic dna - human adult normal tissue: peripheral blood leukocyte #cp-d300d1234148 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioChain Institute blood leukocytes
    Blood Leukocytes, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/bio_rxiv__2019__12__19__876144-89-17-29
    Average 90 stars, based on 1 article reviews
    blood leukocytes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioChain Institute human adult normal peripheral blood leukocyte genomic dna
    Human Adult Normal Peripheral Blood Leukocyte Genomic Dna, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/pmc06580525-41-8-18
    Average 90 stars, based on 1 article reviews
    human adult normal peripheral blood leukocyte genomic dna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioChain Institute human adult normal peripheral blood leukocyte dna
    A representative gel following PCR amplification of mitochondrial and nuclear <t>DNA</t> sequences. Amplification of MT-CO1 , CDH1 , CDKN2A , and LINE-1 in <t>extracted</t> <t>mtDNA</t> (lanes 1 to 4) and control DNA from human adult normal peripheral blood leukocyte (Biochain, Newark, CA, USA) (lanes 6 to 9) were visualized on a 2% agarose gel. The fifth lane contains a DNA size marker.
    Human Adult Normal Peripheral Blood Leukocyte Dna, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/pmc04404685-103-5-12
    Average 90 stars, based on 1 article reviews
    human adult normal peripheral blood leukocyte dna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    97
    AMS Biotechnology leukocyte genomic dna
    <t>LCM-RRBS</t> workflow. A complex tissue is dissected using LCM. Extracted <t>DNA</t> is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.
    Leukocyte Genomic Dna, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/Genomic+DNA+-+Human+Adult+Normal+Tissue%3A+Peripheral+Blood+Leukocyte%2C+from+a+single+donor/pmc03675465-76-9-13
    Average 97 stars, based on 1 article reviews
    leukocyte genomic dna - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    90
    BioChain Institute leukocyte
    <t>LCM-RRBS</t> workflow. A complex tissue is dissected using LCM. Extracted <t>DNA</t> is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.
    Leukocyte, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+adult+normal+peripheral+blood+leukocyte+genomic+dna/pmc02290817-304-9-17
    Average 90 stars, based on 1 article reviews
    leukocyte - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    A representative gel following PCR amplification of mitochondrial and nuclear DNA sequences. Amplification of MT-CO1 , CDH1 , CDKN2A , and LINE-1 in extracted mtDNA (lanes 1 to 4) and control DNA from human adult normal peripheral blood leukocyte (Biochain, Newark, CA, USA) (lanes 6 to 9) were visualized on a 2% agarose gel. The fifth lane contains a DNA size marker.

    Journal: Clinical Epigenetics

    Article Title: Platelet mitochondrial DNA methylation: a potential new marker of cardiovascular disease

    doi: 10.1186/s13148-015-0078-0

    Figure Lengend Snippet: A representative gel following PCR amplification of mitochondrial and nuclear DNA sequences. Amplification of MT-CO1 , CDH1 , CDKN2A , and LINE-1 in extracted mtDNA (lanes 1 to 4) and control DNA from human adult normal peripheral blood leukocyte (Biochain, Newark, CA, USA) (lanes 6 to 9) were visualized on a 2% agarose gel. The fifth lane contains a DNA size marker.

    Article Snippet: In addition to extracted mtDNA, human adult normal peripheral blood leukocyte DNA (Biochain, Newark, CA, USA) was used as a control.

    Techniques: Amplification, Agarose Gel Electrophoresis, Marker

    Technical replicates and quantitative validation of mtDNA pyrosequencing assays. Spearman correlation coefficients ( r ) of the technical replicates (replicates 1 and 2) for the designed pyrosequencing assays were (a) 0.97 for MT-CO1 , (b) 0.93 for MT-CO2 , and (c) 0.76 for MT-CO3 . The plot curve is displayed with a 95% confidence band. The quantitative validation of 0% and 100% methylated DNA for the (d) MT-CO1 , (e) MT-CO2 , and (f) MT-CO3 assays (red circle) were compared with 0% and 100% control oligonucleotides (black rectangle).

    Journal: Clinical Epigenetics

    Article Title: Platelet mitochondrial DNA methylation: a potential new marker of cardiovascular disease

    doi: 10.1186/s13148-015-0078-0

    Figure Lengend Snippet: Technical replicates and quantitative validation of mtDNA pyrosequencing assays. Spearman correlation coefficients ( r ) of the technical replicates (replicates 1 and 2) for the designed pyrosequencing assays were (a) 0.97 for MT-CO1 , (b) 0.93 for MT-CO2 , and (c) 0.76 for MT-CO3 . The plot curve is displayed with a 95% confidence band. The quantitative validation of 0% and 100% methylated DNA for the (d) MT-CO1 , (e) MT-CO2 , and (f) MT-CO3 assays (red circle) were compared with 0% and 100% control oligonucleotides (black rectangle).

    Article Snippet: In addition to extracted mtDNA, human adult normal peripheral blood leukocyte DNA (Biochain, Newark, CA, USA) was used as a control.

    Techniques: Methylation

    LCM-RRBS workflow. A complex tissue is dissected using LCM. Extracted DNA is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.

    Journal: Nucleic Acids Research

    Article Title: Laser capture microdissection–reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    doi: 10.1093/nar/gkt230

    Figure Lengend Snippet: LCM-RRBS workflow. A complex tissue is dissected using LCM. Extracted DNA is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.

    Article Snippet: RRBS was performed on 400 ng of commercially purchased leukocyte genomic DNA (D1234148, Amsbio) and genomic DNA extracted from a mouse liver as previously described ( ).

    Techniques: Methylation, Selection, Amplification

    LCM-RRBS is reproducible and robust across 1 ng extracted from bulk fresh frozen and FFPE samples. CGI methylation (top panels) and the methylation at 2-kb regions flanking the TSS (bottom panels) were compared between ( A ) 1 ng (LCM-RRBS) and 400 ng of purified leukocyte genomic DNA (RRBS), and ( B ) 1 ng of FFPE DNA and 1 ng of fresh frozen genomic DNA extracted from the same endometrial tumor (LCM-RRBS).

    Journal: Nucleic Acids Research

    Article Title: Laser capture microdissection–reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    doi: 10.1093/nar/gkt230

    Figure Lengend Snippet: LCM-RRBS is reproducible and robust across 1 ng extracted from bulk fresh frozen and FFPE samples. CGI methylation (top panels) and the methylation at 2-kb regions flanking the TSS (bottom panels) were compared between ( A ) 1 ng (LCM-RRBS) and 400 ng of purified leukocyte genomic DNA (RRBS), and ( B ) 1 ng of FFPE DNA and 1 ng of fresh frozen genomic DNA extracted from the same endometrial tumor (LCM-RRBS).

    Article Snippet: RRBS was performed on 400 ng of commercially purchased leukocyte genomic DNA (D1234148, Amsbio) and genomic DNA extracted from a mouse liver as previously described ( ).

    Techniques: Methylation, Purification

    LCM-RRBS is robust across microdissected samples collected from fresh frozen and FFPE tissues. Fresh frozen and FFPE mouse liver was collected for DNA methylation profiling. LCM was used to collect tissue from areas ranging in size from 20 to 2 mm 2 . CGI methylation (top panels) and methylation at 2-kb regions flanking the TSS (bottom panels) were compared between ( A ) fresh frozen samples (LCM-RRBS) and 400 ng of purified mouse liver genomic DNA (RRBS), and ( B ) FFPE samples (LCM-RRBS) and 400 ng of purified mouse liver genomic DNA (RRBS).

    Journal: Nucleic Acids Research

    Article Title: Laser capture microdissection–reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    doi: 10.1093/nar/gkt230

    Figure Lengend Snippet: LCM-RRBS is robust across microdissected samples collected from fresh frozen and FFPE tissues. Fresh frozen and FFPE mouse liver was collected for DNA methylation profiling. LCM was used to collect tissue from areas ranging in size from 20 to 2 mm 2 . CGI methylation (top panels) and methylation at 2-kb regions flanking the TSS (bottom panels) were compared between ( A ) fresh frozen samples (LCM-RRBS) and 400 ng of purified mouse liver genomic DNA (RRBS), and ( B ) FFPE samples (LCM-RRBS) and 400 ng of purified mouse liver genomic DNA (RRBS).

    Article Snippet: RRBS was performed on 400 ng of commercially purchased leukocyte genomic DNA (D1234148, Amsbio) and genomic DNA extracted from a mouse liver as previously described ( ).

    Techniques: DNA Methylation Assay, Methylation, Purification

    DNA methylation profiling of GDX-induced adrenocortical neoplasms and adjacent normal tissue using LCM-RRBS. The adrenal glands of three ovariectomized DBA/2J mice were fresh frozen in Tissue-tek O.C.T. compound, cryosectioned and stained. Shown are representative cryosections pre- and post-LCM. Normal cells in the zona fasciculata contain large lipid droplets that are easily recognized. In contrast, neoplastic cells distort the normal adrenal zonal architecture and contain relatively few lipid droplets. The microdissected normal tissue included zona glomerulosa and zona fasciculata cells; care was taken to avoid dissection of X-zone (X), medulla (M) or capsule cells, as these cell types have distinct developmental origins , and therefore may have different epigenetic fingerprints. An average of 5.5 mm 2 of neoplastic (red) and normal (green) tissue per adrenal pair was collected and analyzed using LCM-RRBS.

    Journal: Nucleic Acids Research

    Article Title: Laser capture microdissection–reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    doi: 10.1093/nar/gkt230

    Figure Lengend Snippet: DNA methylation profiling of GDX-induced adrenocortical neoplasms and adjacent normal tissue using LCM-RRBS. The adrenal glands of three ovariectomized DBA/2J mice were fresh frozen in Tissue-tek O.C.T. compound, cryosectioned and stained. Shown are representative cryosections pre- and post-LCM. Normal cells in the zona fasciculata contain large lipid droplets that are easily recognized. In contrast, neoplastic cells distort the normal adrenal zonal architecture and contain relatively few lipid droplets. The microdissected normal tissue included zona glomerulosa and zona fasciculata cells; care was taken to avoid dissection of X-zone (X), medulla (M) or capsule cells, as these cell types have distinct developmental origins , and therefore may have different epigenetic fingerprints. An average of 5.5 mm 2 of neoplastic (red) and normal (green) tissue per adrenal pair was collected and analyzed using LCM-RRBS.

    Article Snippet: RRBS was performed on 400 ng of commercially purchased leukocyte genomic DNA (D1234148, Amsbio) and genomic DNA extracted from a mouse liver as previously described ( ).

    Techniques: DNA Methylation Assay, Staining, Dissection

    Validation of differentially methylated promoters. The DNA methylation of one hypermethylated and three hypomethylated promoters was interrogated by BSP and sequencing across enriched neoplastic and normal samples. All genes show a statistically significant difference (Fisher’s exact test, P < 10 −15 ) in DNA methylation using BSP. Each colored box represents an individual CpG dinucleotide within a 2-kb region centered around the TSS. High (yellow), moderate (black), low (blue) and undetermined methylation levels are shown for each CpG. The mean methylation of each region interrogated is shown to the right of each heatmap. The red box indicates the region of the promoter that was interrogated by LCM-RRBS and BSP.

    Journal: Nucleic Acids Research

    Article Title: Laser capture microdissection–reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    doi: 10.1093/nar/gkt230

    Figure Lengend Snippet: Validation of differentially methylated promoters. The DNA methylation of one hypermethylated and three hypomethylated promoters was interrogated by BSP and sequencing across enriched neoplastic and normal samples. All genes show a statistically significant difference (Fisher’s exact test, P < 10 −15 ) in DNA methylation using BSP. Each colored box represents an individual CpG dinucleotide within a 2-kb region centered around the TSS. High (yellow), moderate (black), low (blue) and undetermined methylation levels are shown for each CpG. The mean methylation of each region interrogated is shown to the right of each heatmap. The red box indicates the region of the promoter that was interrogated by LCM-RRBS and BSP.

    Article Snippet: RRBS was performed on 400 ng of commercially purchased leukocyte genomic DNA (D1234148, Amsbio) and genomic DNA extracted from a mouse liver as previously described ( ).

    Techniques: Methylation, DNA Methylation Assay, Sequencing